 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yckE |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yckE | + | 369818..371251 |
| Operon evidence: | Northern blotting (1.5 kb transcript) |
|---|---|
| Reference: | BSORF |
| Comments: | The Northern blotting experiments listed in BSORF also show a longer 2.4 kb transcript. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAGAGTCCCTGAGAGTTATTCTCTCAGGGGTTTTTCATTACACAG >>>>>>>>>> <<<<<<<<<< |
yckE |
|