 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yfhGH |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yfhG | + | 925633..926427 | COG2137R | |||
| yfhH | + | 926429..926743 |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF, Genbank D85082 |
| Comments: | BSORF shows a yghGH and a monocistronic yfhH transcript, suggesting that an internal promoter exists upstream of yghH. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AACAGGAGGCTGATGATCAGCCTCTTTTTGTTTGCAGCA >>>>>>>> <<<<<<<< |
yfhH |
|