 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yfiBC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yfiB | + | 893239..894960 | ||||
| yfiC | + | 895619..897433 | COG1132V |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF |
| Comments: | Northern blotting results in BSORF suggest the existence of an internal promoter downstream of yfiB. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAATAGACCTTTGTCCTGCACAGAGGTCTTTTTTTGTTACAGT >>>>>>>>> <<<<<<<<< |
yfiC |
|