 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yfiGHI |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yfiG | + | 900080..901528 | COG2814G | |||
| yfiH | + | 901555..902496 | COG1082G | |||
| yfiI | + | 902506..903687 | COG0673R |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF |
| Comments: | Northern blotting results in BSORF suggest the existence of internal promoters upstream of yfiH and yfiI. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATGCGCCGCATATGACATAAAGTTCATATGCGGTTTTTATTTTCCAGA >>>>>>>>>>> <<<<<<<<<<<< |
yfiI |
|