 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yfiSR |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yfiS | - | 912547..913800 | COG2814G | |||
| yfiR | - | 911964..912581 | COG1309K |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF, Genbank D85082 |
| Comments: | Northern blotting results in BSORF suggest the existence of an internal promoter upstream of yfiR. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GAAACGCGGCAGGAGCCCTCCTGCCGCTTGTTTTTCACCCTG >>>>>>>>> <<<<<<<<< |
yfiR |
|