 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yflMK |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yflM | + | 836071..837081 | ||||
| yflK | + | 838077..838742 | COG2258S | x0887-BAC |
| Operon evidence: | Northern blotting; downstream genes are on the opposite strand |
|---|---|
| Reference: | BSORF |
| Comments: | Note that the gene yflL is located between yflM and yflK, but on the opposite strand. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCCGCGCATATCAACGTGCGCGGCTTTGCCATATTTAAG >>>>>>>>> <<<<<<<<< |
yflK |
|