Regulated Operon: | ykvR |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
ykvR | + | 1447251..1447541 |
Operon evidence: | Genome analysis; downstream gene is on the opposite strand |
---|---|
Reference: | Au N, et al. (2005) |
Comments: |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
LexA | Negative | ND | 1447123..1447145 | TTAACGAACGTATGTTTGTAAAG |
Au N, et al. (2005): GS |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AATAGACAAAAACGCCGATTCATGATCGGTGTTTTTTATGTAAAAA >>>>>>>> <<<<<<<< |
ykvR |
|