Regulated Operon: | yndA |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
yndA | + | 1905809..1906207 |
Operon evidence: | Genome analysis; upstream and downstream genes are on the opposite strand |
---|---|
Reference: | |
Comments: |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
SigE | Promoter | ND | ND | ND |
Feucht A, et al. (2003): AR DB RG |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
GGAAAAAAACAAAAAAGAGAGATACCTCTCTCTTTTTTATTCTTCGA >>>>>> <<<<<< |
yndA |
|