 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yoaW |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yoaW | G4 | - | 2046980..2047411 |
| Operon evidence: | downstream gene is in the opposite direction |
|---|---|
| Reference: | Genbank AF027868 |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| AbrB | Negative | ND | ND | ND |
Hamon MA, et al. (2004): AR RT-PCR |
| SigE | Promoter | -39:+4 | 2047675..2047717 | GCCTGAATATTTCTTTGAGCTAATGAATACAATAAATCGATAG |
Rather PN, et al. (1986): S1 RO |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GCCAAGCTAATGTCTACATGCAGACATTAGCTTTTTTCATTGTTTA >>>>>>>>>> <<<<<<<<<< |
yoaW |
|