 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yolC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yolC | + | 2272156..2272491 |
| Operon evidence: | Genome analysis; upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Au N, et al. (2005) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| LexA | Negative | ND | 2272011..2272034 | TTAACAGAACAAACGTTCTTCATT |
Au N, et al. (2005): GS |
| LexA | Negative | ND | 2272041..2272064 | AAACCAGAACAAAAGTTCGATGTA |
Au N, et al. (2005): GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CCCAATAAGTAAAATGCCCAGCTCTTTATTTAAGCTGGGCATTGTTTTCATTATTT >>>>>>>>> <<<<<<<<< |
yolC |
|