| Regulated Operon: | yozLK-yobH |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yozL | - | 2064540..2064833 | ||||
| yozK | - | 2064200..2064547 | COG0389L | |||
| yobH | - | 2063510..2064163 | COG0389L |
| Operon evidence: | Genome analysis; upstream and downstream gene are on the opposite strand |
|---|---|
| Reference: | Au N, et al. (2005) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| LexA | Negative | ND | 2064927..2064950 | TACATCGAACTTTTGTTCTGATCT |
Au N, et al. (2005): GS |
| LexA | Negative | ND | 2064897..2064920 | AATAAGGAACGTTTGTTCTGTTGA |
Au N, et al. (2005): GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TTTTAAAAACTCAATATTACTAATACAATTATTGAAATTATTTTTTAATTCC >>>>>> <<<<<< |
yobH |


|