Regulated Operon: | ypuGHI |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
ypuG | - | 2425831..2426586 | COG1354S | |||
ypuH | - | 2424442..2425035 | ||||
ypuI | - | 2424654..2425193 |
Operon evidence: | Northern blotting (2.0 kb transcript) |
---|---|
Reference: | Azevedo V, et al. (1993), Buchanan CE & Ling ML (1992) |
Comments: | Internal promoter in front of ypuI, leading to a 0.5 kb transcript. |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
GTTTACTCTCCCTTTTTCAGGGAGAGTTTTTTTATGTTTGC >>>>>>>> <<<<<<<< |
ypuH |
|