Regulated Operon: | yqhB |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
yqhB | + | 2561585..2562913 | COG1253R | x0520-BAC-3 |
Operon evidence: | Genome analysis; upstream and downstream gene are on the opposite strand |
---|---|
Reference: | Au N, et al. (2005) |
Comments: |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
LexA | Negative | ND | 2561450..2561473 | TCCTCCAAACTTTTGTTCTTTATT |
Au N, et al. (2005): GS |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
GCTGTTCAGCTGCTATCTTTCAAGATAAACATGGCAAAGGCATCAACACTCTTTTATTTTAAACCC >>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<<<< |
yqhB |
|