Regulated Operon: | yqjPQ-dsdA-coaA-yqjT |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
yqjP | - | 2471787..2472746 | COG0491R | |||
yqjQ | - | 2471002..2471781 | COG0300R | |||
dsdA | yqjR | - | 2469580..2470926 | COG3048E | dsdA-BAC | |
coaA | yqjS | - | 2468549..2469508 | COG1072H | ||
yqjT | - | 2468159..2468545 | COG0346E |
Operon evidence: | Northern blotting |
---|---|
Reference: | BSORF |
Comments: | Northern blotting results in BSORF suggest the existence of an internal promoter in front of coaA |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
GTTTGCGGGAGAGATTCATTCTCTTCCGTTTTTTATTTAAAGC >>>>>>>>> <<<<<<<<< |
yqjT |
|