Regulated Operon: | yqjYZ-yqkABC |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
yqjY | - | 2463571..2464041 | COG0456R | |||
yqjZ | - | 2463217..2463561 | COG2329R | |||
yqkA | - | 2462193..2463224 | COG2320S | x0490-BAC yqkA-BAC | ||
yqkB | - | 2461873..2462196 | COG4918S | |||
yqkC | - | 2461621..2461860 |
Operon evidence: | Northern blotting |
---|---|
Reference: | BSORF |
Comments: | Northern blotting results in BSORF suggest the existence of internal promoters in front of yqkB and yqkC |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAAGCGAAAGAGCCGAAGAGGCCTTTCGCTTTTTTATTCTGTTG >>>>>>>>>>> <<<<<<<<<< |
yqkC |
|