Regulated Operon: | yrvE-apt |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
yrvE | - | 2822645..2825005 | ||||
apt | - | 2822901..2823413 | COG0503F | apt-STA apt-STR |
Operon evidence: | Northern blotting (3.0 kb transcript) |
---|---|
Reference: | Nickel M, et al. (2004) |
Comments: | Internal promoter in front of apt, leading to a 0.6 kb transcript. Readthrough at this terminator leads to a 5.8 kb yrvE-apt-relA-yrvI transcript and a 3.3 kb apt-relA-yrvI transcript. |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAAGCACTCCATGTCAGGGTGCTTTTTTCCTATTGTT >>>>>> <<<<<< |
apt |
|