| Regulated Operon: | ytrABCDEF |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ytrA | - | 3118847..3119239 | COG1725K | |||
| ytrB | - | 3117976..3118854 | COG1131V | |||
| ytrC | - | 3116996..3117982 | ||||
| ytrD | - | 3115989..3116966 | ||||
| ytrE | - | 3115279..3115974 | COG1136V | |||
| ytrF | - | 3113979..3115289 | COG4591M |
| Operon evidence: | Northern blotting (5.5 kb transcript) |
|---|---|
| Reference: | Yoshida KI, et al. (2000), Lapidus A, et al. (1997), Genbank AF008220 |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -41:+6 | 3119478..3119524 | AAAGGATTGACTTTGTGAGTCAAAGTATTTATTGTATTAAGTGTACT |
Yoshida KI, et al. (2000): NB PE |
| YtrA | Negative | ND | ND | ND |
Yoshida KI, et al. (2000): RG NB PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AACGAGCCGGCTGAGACAGCCGGCTTTTTCTATAGCGCA >>>>>>>> <<<<<<<< |
ytrF |


|