 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yuzC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yuzC | + | 3257693..3258061 |
| Operon evidence: | upstream and downstream genes are in the opposite direction |
|---|---|
| Reference: | Eichenberger P, et al. (2003), Genbank AF008220 |
| Comments: | The 3' ends of the yuzC and the converging yuxH coding regions overlap. A terminator for yuxH was found experimentally downstream of yuzC. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigE | Promoter | -37:+13 | 3257629..3257678 | TTTGTCATATTCGGCAATTAGGGATCTATACATATAGAAACATCCTTTTT |
Eichenberger P, et al. (2003): AR, 5'-RACE-PCR Kuwana R, et al. (2002): SDS-PAGE, RG |
|