 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | ywoG |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ywoG | + | 3749487..3750677 | COG2814G |
| Operon evidence: | Genome analysis; downstream genes are on the opposite strand |
|---|---|
| Reference: | Presecan E, et al. (1997), Genbank Z82987 |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TGTCAGACTGCCGGGAAATCCCGGCAGTCTTTTTTCCATTAAAA >>>>>>>>>> <<<<<<<<<< |
ywoG |
|