 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | ywzA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ywzA | + | 3918777..3919022 | COG2261S |
| Operon evidence: | Genome analysis; upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Presecan E, et al. (1997) |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AGCAGCACCCGAAGCGTCAGCGCTTTGGGTGTTTGTTTTGCCATAA >>>>>>>>>>> <<<<<<<<<<< |
ywzA |
|