 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yxaC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yxaC | + | 4110217..4110909 | COG1346M |
| Operon evidence: | Northern blotting (1.3 kb transcript); upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Yoshida K, et al. (2000) |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AGAAAGACTGCCCCGGGGGAGGGCAGTCTTTTTCGTTTAAGAA >>>>>>>> <<<<<<<< |
yxaC |
|