Regulated Operon: | yxaC |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
yxaC | + | 4110217..4110909 | COG1346M |
Operon evidence: | Northern blotting (1.3 kb transcript); upstream and downstream genes are on the opposite strand |
---|---|
Reference: | Yoshida K, et al. (2000) |
Comments: |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AGAAAGACTGCCCCGGGGGAGGGCAGTCTTTTTCGTTTAAGAA >>>>>>>> <<<<<<<< |
yxaC |
|