 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yxaD |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yxaD | - | 4109185..4109616 | COG1846K |
| Operon evidence: | Northern blotting (0.6 kb transcript); upstream and downstream gene are on the opposite strand |
|---|---|
| Reference: | Yoshida K, et al. (2000) |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACCCATGGTTCGCTGGAACAGCATGGGTTTTTCTTATGGTCA >>>>>>>>>> <<<<<<<<<<<< |
yxaD |
|