| Regulated Operon: | yxaI |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yxaI | + | 4104444..4104899 | COG1714S |
| Operon evidence: | Northern blotting (0.6 kb transcript); upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Yoshida K, et al. (2000) |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGTCTAGACGCCAATAGGCATCTAGACTTTTGTTTTCTTTGC >>>>>>>>>>> <<<<<<<<<<< |
yxaI |


|