Regulated Operon: | yxbG |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
yxbG | yxaU | + | 4091845..4092666 | COG1028IQR |
Operon evidence: | Northern blotting (0.9 kb transcript); upstream and downstream gene are on the opposite strand |
---|---|
Reference: | Yoshida K, et al. (2000) |
Comments: |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AATAAGAGAGGGAGCCCCCTCTCTTTTTGTCTTTTAAA >>>>>>> <<<<<<< |
yxbG |
|