 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yxeFGH |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yxeF | - | 4065074..4065508 | ||||
| yxeG | - | 4064536..4065093 | ||||
| yxeH | - | 4063684..4064496 | COG0561R |
| Operon evidence: | Northern blotting (2.5 kb transcript) |
|---|---|
| Reference: | Yoshida K, et al. (2000), BSORF |
| Comments: | Internal promoter in front of yxeH, leading to a 0.9 kb transcript. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAATCCAGCCTTCTAAAGGCTGGATTTTTTCGTTTTATTTG >>>>>>>>>> <<<<<<<<<< |
yxeH |
|