Regulated Operon: | yxiD-yxxD-yxxE |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
yxiD | - | 4036784..4038493 | COG5444S | |||
yxxD | - | 4036344..4036787 | ||||
yxxE | - | 4035990..4036298 |
Operon evidence: | Genome analysis |
---|---|
Reference: | Le Coq D, et al. (1995), Yoshida K, et al. (2000) |
Comments: | yxiD and yxxD overlap. Northern blotting by Yoshida et al. showed one 1 kb transcript in the yxiD-yxxD region and one 700 bp transcript for yxxE. Both of these transcripts are too long to infer that these genes are transcribed monocistronically, but too short to cover a yxiD-yxxD-yxxE operon. |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
CATAACCTTGATTGGAAAAAATGCCTTTCAAGGTTTTTAATTACAATA >>>>>>>>>> <<<<<<<<<< |
yxxE |
|