Regulated Operon: | yxkF-msmX |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
yxkF | - | 3985351..3986244 | COG2508TQ | |||
msmX | yxkG | - | 3984133..3985230 | COG3839G | msmX-BAC |
Operon evidence: | Northern blotting (2.3 kb transcript) |
---|---|
Reference: | Yoshida K, et al. (2000), BSORF |
Comments: | An internal promoter in front of msmX leads to a 1.3 kb transcript. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
CcpA | Negative | ND | 3985246..3985268 | TATAAGAAAGCGTTTACAATAAC |
Miwa Y, et al. (2000): RG |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAACCGGACATGGAGACATGTCCGGTTTTTTGCTATTGAA >>>>>>>>> <<<<<<<<< |
msmX |
|