Regulated Operon: | yxkH |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
yxkH | - | 3983187..3984026 | COG0726G |
Operon evidence: | Northern blotting; downstream gene is on the opposite strand |
---|---|
Reference: | Yoshida K, et al. (2000), BSORF |
Comments: | A 1.0 kb and a 1.2 kb transcript was found. The significance of the two transcript lengths is unknown. |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
GCTGTCCGCCTGCTGGCGGCTTTTGTTTTTCGAGG >>>>> <<<<< |
yxkH |
|