 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yyaF-rpsF-ssb-rpsR |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yyaF | - | 4199843..4200943 | COG0012J | x0048-BAC | ||
| rpsF | - | 4199445..4199732 | COG0360J | rpsF-STA rpsF-STR | ||
| ssb | - | 4197910..4198428 | single-strand DNA-binding protein | ssb-BAC-1 ssb-BAC-2 ssb-OYP ssb-STA ssb-STR x1145-LAB | ||
| rpsR | - | 4198603..4198842 | COG0238J | rpsR-BAC rpsR-LAB rpsR-STA rpsR-STR |
| Operon evidence: | Northern blotting (2.4 kb transcript) |
|---|---|
| Reference: | Lindner C, et al. (2004) |
| Comments: | Internal promoter in front of rpsF, leading to a 1.2 kb transcript. Northern blotting results in BSORF also show a yyaDEF-rpsF-ssb-rpsR transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| ComK | Positive | ND | 4201054..4201070 | ATCAAAGGGATTGGCAA |
Ogura M, et al. (2002): AR RG HM DB |
| ComK | Positive | ND | 4201037..4201054 | AGCTGAAAATGCTTTTTT |
Ogura M, et al. (2002): AR RG HM DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GTAAAGAGCAAGGACCTTCGGGTTCTTGCTCTTTTTTATAGGGGGG >>>>>>>>>>> <<<<<<<<<<< |
rpsR |
|