 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Factor type | two-component response regulator |
|---|---|
| SWISS-PROT | ND |
| SubtiList | ND |
| Consensus seq. | TTCAAT |
| Comment | deoxyribonucleoside regulator; represses the expression of a downstream operon, dra-nupC-pdp; 30% identical to the sorC repressor from K. pneumoniae |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| deoR-dra-nupC-pdp | dra | SigA | Negative | 4052324..4052362 | -60:-22 | ATTGAACAAAATTTCAATTACCAATTTACATATGTTCAA |
Zeng X, et al. (2000): GS FT Zeng X & Saxild HH (1999): DP RG DB SDM GS Saxild HH, et al. (1996): DB HM |
|