 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Factor type | Unique (ATP-GTP binding) |
|---|---|
| SWISS-PROT | ND |
| SubtiList | ND |
| Consensus seq. | ND |
| Comment | putative helix-turn-helix type regulator; located immediately upstream of gutB and is transcribed in the opposite direction; probably acts as an activator |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| gutBP | gutB | SigA | Positive | 667324..667352 | -78:-50 | ATAAAAGTACAGTGCCGCTGTCCTTTTAT |
Ye R, et al. (1994): DB Ye R, et al. (1994): DP RG Poon KK, et al. (2001): GS RG |
|