Transcription factor: PyrR

Factor type	ND
SWISS-PROT	ND
SubtiList	ND
Consensus seq.	ARUCCNGNGAGGYU
Comment	Involved in repression of the pyr operon by transcriptional attenuation in the presence of excess UTP. Tight binding to the pyr mRNA requires the (C)NGNGA sequence.
Link to	Phylogenetic profile

Operon	Regulated Gene	Sigma	Regulation	Absolute position	Location	Binding seq.(cis-element)	Experimental evidence
pyrRPBCAAABKDFE	pyrR	SigA	Negative	`1618156..1618215`	None	TGAATAGATTCTTTAAAACAGTCCAGAGAGGCTGAGAAGGATAACGGATAGACGGGATGC	Lu Y, et al. (1995): DB RG Turner RJ, et al. (1994): NB RG DP OV Ghim S-Y & Switzer RL (1996): Classical genetics, RG Lu Y & Switzer RL (1996): Titration Lu Y & Switzer RL (1996): RO NB, in-vitro transcription Lu Y, et al. (1996): In-vitro transcription Bonner ER, et al. (2001): GS FT Zhang H & Switzer RL (2003): RO
pyrRPBCAAABKDFE	pyrP	SigA	Negative	`1618850..1618910`	None	TAGATCACCTTTTTAAGGGCAATCCAGAGAGGTTGCAAAGAGGTGCACAACAAAGGCCCAA	Turner RJ, et al. (1994): NB RG DP OV Lu Y, et al. (1996): DB RG Ghim S-Y & Switzer RL (1996): Classical genetics, RG Lu Y & Switzer RL (1996): Titration Lu Y & Switzer RL (1996): RO NB, in-vitro transcription Turner RJ, et al. (1998): GS DP Bonner ER, et al. (2001): GS FT SDM Zhang H & Switzer RL (2003): RO Zhang H, et al. (2005): SDM RG
pyrRPBCAAABKDFE	pyrB	SigA	Negative	`1620326..1620385`	None	TTTAAAACCTTTTAATGAAAGTCCAGAGAGGCTTGGAAGGGTTATGAAGAGAAGGAAGCT	Lu Y, et al. (1996): DB RG Quinn CL, et al. (1991): S1 Turner RJ, et al. (1994): NB RG DP OV Ghim S-Y & Switzer RL (1996): Classical genetics, RG Lu Y & Switzer RL (1996): Titration Lu Y & Switzer RL (1996): RO NB, in-vitro transcription Bonner ER, et al. (2001): GS FT Zhang H & Switzer RL (2003): RO