Promoter:

abrB

# of regulatory region	2
Direction	-
Start position	45136
Operon	ND
Profile	bifunctional transcriptional regulator expressed during the transition state transcriptional regulator alternate gene name: cpsX

---

Links to

Function analysis ( produced by Japan Functional Analysis Network)

Transcriptional profile of early to middle spolulation (produced by Logick lab.)

---

Binding factor	Regulation	Location	Binding seq.(cis-element)	Exp.	Author	Year
AbrB	Negative	-43:-14	CAAAATGATTGACGATTATTGGAAACCTTG	GS FT	Strauch MA, et al.	1989
Spo0A	Negative				Hoch Two-component signal transduction ASM Press p129-144	1995

---

---

Alignment Result