Promoter:

araE

# of regulatory region	3
Direction	-
Start position	3484529
Operon	monocistronic
Profile	permease L-arabinose transport alternate gene name: yvbR induced by L-arabinose and repressed by glucose

---

Links to

Function analysis ( produced by Japan Functional Analysis Network)

Transcriptional profile of early to middle spolulation (produced by Logick lab.)

---

Binding factor	Regulation	Location	Binding seq.(cis-element)	Exp.	Author	Year
AraR	Negative	Unknown	Unknown	DB HM	Sa Nogueira I, et al.	1997
araE	Negative	-6:+14	ATATTTGTACGTACTAATTA	FT	Mota LJ. et al.	1999
araE	Negative	+39:+55	TATAAGTACGTACAATT	FT	Mota LJ. et al.	1999

---