Promoter:

araR

# of regulatory region	2
Direction	+
Start position	3484667
Operon	monocistronic
Profile	transcriptional regulator (LacI family) negative regulation of the L-arabinose metabolic operon (araABDLMNPQ-abfA) alternate gene name: araC, yvbS

---

Links to

Function analysis ( produced by Japan Functional Analysis Network)

Transcriptional profile of early to middle spolulation (produced by Logick lab.)

---

Binding factor	Regulation	Location	Binding seq.(cis-element)	Exp.	Author	Year
AraR	Negative	Unknown	Unknown	DB HM	Sa Nogueira I, et al.	1997
araR	Negative	-6:+15	AAATTTGTCCGTATACATTT	FT	Mota LJ. et al.	1999

---

Alignment Result