Promoter:

bglP

# of regulatory region	2
Direction	-
Start position	4034396
Operon	bglPH;aryl-beta-glucoside utilization
Profile	phosphotransferase system (PTS) beta-glucoside-specific enzyme IIABC component alternate gene name: sytA expression of the operon is induced by salicin in the absense of the inducer, a transcript of about 110 nucleotides is produced this antitermination process is mediated by LicT

---

Links to

Function analysis ( produced by Japan Functional Analysis Network)

Transcriptional profile of early to middle spolulation (produced by Logick lab.)

---

Binding factor	Regulation	Location	Binding seq.(cis-element)	Exp.	Author	Year
CcpA	Negative	-43:-30	(TGAAAGCGTTGACA)	RO DP	Kruger S, et al.	1996
LicT	Positive	+25:+53	GGATTGTTACTGCGAAAGCAGGCAAAACC	RO DP	Kruger S, et al.	1996

---

---

Alignment Result