Promoter:

sinI

# of regulatory region	1
Direction	+
Start position	2551722
Operon	sinIR
Profile	antagonist of SinR prevents SinR from binding to its target sequence on aprE

---

Links to

Function analysis ( produced by Japan Functional Analysis Network)

Transcriptional profile of early to middle spolulation (produced by Logick lab.)

---

Binding factor	Regulation	Location	Binding seq.(cis-element)	Exp.	Author	Year
AbrB	Negative	No data	ATTTAATGGCAAATGACTTCCAGAGA	GS FT	Strauch MA, et al.	1995

---

Alignment Result