Promoter:

ycdH

# of regulatory region	1
Direction	+
Start position	308845
Operon	ycdHI-yceA
Profile	similar to adhesion protein

---

Links to

Function analysis ( produced by Japan Functional Analysis Network)

Transcriptional profile of early to middle spolulation (produced by Logick lab.)

---

Binding factor	Regulation	Location	Binding seq.(cis-element)	Exp.	Author	Year
Zur	Negative	Unknown	ACAAAATCGTTATCATTTTG	mutation GS homology	Gaballa A et al.	1998

---

Alignment Result