Transcription factor: |
PurR |
| Factor type | PURINE BIOSYNTHESIS |
|---|---|
| SWISS-PROT | P37551 |
| SubtiList | BG10110 |
| Consensus seq. | |
| Comment | a purine repressor which mediates adenine nucleotide-dependent regulation of pur operon a GAAC-N24-GTTC motif seems necessary for its binding but this motif was not required for its binding to purA |
| Promoter | Sigma | Regulation | Location | Binding seq.(cis-element) | Exp. | Author | Year |
|---|---|---|---|---|---|---|---|
| purE | ND | Negative | -75:-44 | GAACATTAGTAGAATGAATTTTTGTATCGTTC | GS FT SDM | Shin BS, et al. | 1997 |
| purA | ND | Negative | (about -130:-30) | Long sequence | GS FT | Shin BS, et al. | 1997 |
| purR | ND | Negative | (about -90:-10) | Long sequence | GS FT | Shin BS, et al. | 1997 |
| pyr | ND | Negative | (about -110:-40) | Long sequence | GS FT | Shin BS, et al. | 1997 |