Transcription factor: |
RocR |
| Factor type | NtrC/NifA |
|---|---|
| SWISS-PROT | P38022 |
| SubtiList | BG10723 |
| Consensus seq. | GCAAAATAATTTTGCA(T/C)T |
| Comment | NtrC/NifA transcriptional activator (cf. LevR) sigma 54-dependent activators generally bind two inverted repeat sequences called UAS, which are located approx. 100bp upstream from the -12/-24 promoters DNA bending is used for activation (AhrC may be involved) inducible by ornithine or citrulline? at least upstream UAS1 is the target of RocR |
| Promoter | Sigma | Regulation | Location | Binding seq.(cis-element) | Exp. | Author | Year |
|---|---|---|---|---|---|---|---|
| rocA | sigL | Positive | -178:-158 | TCCGCAAAATAATTTTGCATT | DP DB | Calogero S, et al. | 1994 |
| rocA | sigL | Positive | -134:-114 | AACGCAAAATAAATTTGCGTT | DP DB | Calogero S, et al. | 1994 |
| rocD | sigL | Positive | -130:-110 | TATGCAAAAGAATTTTGCACT | DP HM | Gardan R, et al. | 1995 |
| rocD | sigL | Positive | -89:-69 | ATATCAGAATGTTTTTGCACC | DP HM | Gardan R, et al. | 1995 |
| rocR | sigA | Negative | -30:-50 | TATGCAAAAGAATTTTGCACT | DB PE | Gardan R, et al. | 1995 |