Transcription factor: |
SenS |
| Factor type | Unique(RNA POLYMERASE SIGMA FACTORS) |
|---|---|
| SWISS-PROT | P21344 |
| SubtiList | BG10747 |
| Consensus seq. | |
| Comment | shows partial homology with the N-terminal core binding domain of sigma factors and a helix-turn-helix motif stimulates the expression of several extracellular protein genes during the onset of stationary phase a 9bp sequence (TTTAGATAA) might be the binding consensus |
| Promoter | Sigma | Regulation | Location | Binding seq.(cis-element) | Exp. | Author | Year |
|---|---|---|---|---|---|---|---|
| senS | ND | Negative? | No data | AAGGCTCTTATCGTTTAGATAAGGGCCTT | RO HB DB HM | Wang LF, et al. | 1990 |
| aprE | ND | Positive | -415:-177 | Unknown | DP HB | McCready PM, et al. | 1992 |