| Factor type | Xre |
|---|---|
| SWISS-PROT | Q07683 |
| SubtiList | BG10299 |
| Consensus seq. | TGCGAAAAGCGAATACCTTCTCGCA (plausible) |
| Comment | helix-turn-helix type repressor regulates the immediately upstream ans operon |
| Link to | Phylogenetic profile |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| ansA | ansA-ansB | SigA | Negative | ND | ND | ND |
DB HM | Sun D, et al. | 1993 |
| ansR | ansR | ND | Negative | ND | ND | ND |
PE, beta-gal | Sun D, et al. | 1991 |