| Factor type | Unique(biotin) |
|---|---|
| SWISS-PROT | P42975 |
| SubtiList | BG11206 |
| Consensus seq. | AATTGTTAACTTTG (plausible) |
| Comment | dual-purpose protein acts as a repressor and has ligase activity |
| Link to | Phylogenetic profile |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| bioW | bioWAFDBI-orf2 | SigA | Negative | 3094554..3094593 | ND | CTAATTGTTAACCTTTGAATATAATTGGTTAACAATTTAG |
DB | Bower S, et al. | 1996 |