| Factor type | |
|---|---|
| SWISS-PROT | P39075 |
| SubtiList | BG10304 |
| Consensus seq. | |
| Comment | a similar factor, BltR, regulates another multidrug transporter operon, Blt the binding activity is enhanced by rhodamine and tetraphenylphosphonium (TPP) |
| Link to | Phylogenetic profile |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| bmr | bmr | ND | Positive | 2493782..2493812 | ND | TTGACTCTCCCCTAGGAGGAGGTCTTACAGT |
DB GS FT | Ahmed M, et al. | 1994 |