| Factor type | two-component response regulator |
|---|---|
| SWISS-PROT | O34534 |
| SubtiList | BG12577 |
| Consensus seq. | |
| Comment | involved in the response to the environmental Mg-citrate complex (positive regulation of citM) |
| Link to | Phylogenetic profile |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| citM | citM-yflN | SigA | Positive | 833564..833614 | -36:-85 | ATCAAAAAGAACAAAACGGTTTTAAAAAATTAAAAATACAAA AAAACCAAA |
Northern blot, FT | Yamamoto, H., et al. | 2000 |
| citM | citM-yflN | SigA | Positive | 833453..833482 | -196:-168 | AACAGCAGGGAAACGAAACGGTTTTTAGAA |
Northern blot, FT | Yamamoto, H., et al. | 2000 |