| Factor type | two-component response regulator |
|---|---|
| SWISS-PROT | P37568 |
| SubtiList | BG10145 |
| Consensus seq. | A/GGTCAAA NAN A/GGTCAAA |
| Comment | binding to a directly repeated heptanucleotide operator sequence (A/GGTCAAANANA/GGTCAAA); three functional domains: HTH DNA-binding, dimerization, and putative heat-sensing domains; active as a dimer; specifically degraded by ClpP and ClpX at 37 degrees C; labile and substrate of the ClpCP protease under stress conditions (autoregulation by controlled proteolysis); negatively regulates its own synthesis |
| Link to | Phylogenetic profile , Weight matrix & Motif alignment |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| clpE | ND | SigA | Negative | 1437244..1437267 | -33:-9 | AAAGTCAAAGATAGTCAGAGTATA |
GS FT | Derre I, et al. | 1999 |
| clpE | ND | SigA | Negative | 1437216..1437240 | -5:+20 | TTAATCAAAGTTGGTCAAACAAACC |
GS FT | Derre I, et al. | 1999 |
| clpE | ND | SigA | Negative | 1437173..1437196 | +40:+63 | TTGGTCAAAGATAGTCAAATATTC |
GS FT | Derre I, et al. | 1999 |
| clpE | ND | SigA | Negative | 1437098..1437121 | -5:+19 | ATAGTCAAAGAAGGTCAAACCCAA |
GS FT | Derre I, et al. | 1999 |
| clpE | ND | SigA | Negative | 1437051..1437075 | +42:+66 | TTGGTCAAAGATGATCAAATTATTA |
GS FT | Derre I, et al. | 1999 |
| clpP | clpP | SigA | Negative | 3545195..3545211 | -20:-36 | GGTCAATAAAGGTCAAA |
GS FT | Derre I, et al. | 1999 |
| clpX | ND | ND | Negative | ND | ND | ND |
ctsR-deletion | Kruger E et al. | 1998 |
| ctsR | ctsR-yacH-yacI-clpC-radA-yacK | SigA | Negative | 101406..101434 | +1:+29 | AAAGTCAAATATAGTCAAAGTCAGTAAAG |
GS FT | Derre I, et al. | 1999 |
| lonA | ND | ND | Negative | ND | ND | ND |
ctsR-deletion | Kruger E et al. | 1998 |
| trxA | ND | ND | Negative | ND | ND | ND |
ctsR-deletion | Kruger E et al. | 1998 |