| Factor type | two-component response regulator |
|---|---|
| SWISS-PROT | P39140 |
| SubtiList | BG10982 |
| Consensus seq. | ATTGAACAAAATTTCAATTACCAATTTACATATGTTCAA |
| Comment | deoxyribonucleoside regulator represses the expression of a downstream operon, dra-nupC-pdp 30% identical to the sorC repressor from K. pneumoniae |
| Link to | Phylogenetic profile |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| dra | dra-nupC-pdp operon | ND | Negative | 4051341..4051379 | -60:-22 | ATTGAACAAAATTTCAATTACCAATTTACATATGTTCAA |
FT | Zeng X, et al. | 2000 |
| dra | ND | ND | Negative | ND | ND | ND |
DB HM | Saxild HH, et al. | 1996 |