| Factor type | Unique(CRP/FNR FAMILY) |
|---|---|
| SWISS-PROT | P46908 |
| SubtiList | BG11343 |
| Consensus seq. | TGTGA------TCACA |
| Comment | same binding consensus with E. coli CAP exists in the narK-fnr operon |
| Link to | Phylogenetic profile , Weight matrix & Motif alignment |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| narG | narGHJI | ND | Positive | 3829034..3829049 | -49:-34 | TGTGACATAGTTCACA |
DB PE | Cruz Ramos H, et al. | 1995 |
| narK | ND | ND | Positive | 3832602..3832617 | -49:-34 | TGTGATGTAATTCACA |
DB PE | Cruz Ramos H, et al. | 1995 |
| ywcJ | ND | ND | Positive | 3904282..3904317 | -59:-24 | AAAAATTAATTGTGAAATACTTCACAATATCGTGCC |
DB PE | Cruz Ramos H, et al. | 1995 |
| ywiD | ND | ND | Positive | 3829698..3829713 | -49:-34 | TGTGAAATACATCACT |
DB PE beta-GAL |
Cruz Ramos H, et al. Marino, M., et al. |
1995 2001 |