| Factor type | LysR |
|---|---|
| SWISS-PROT | ND |
| SubtiList | ND |
| Consensus seq. | T-----------A |
| Comment | it activates the transcription of gltAB in the absense of the normal regulator, GltC it also negatively regulates its own expression cf. GltC |
| Link to | Phylogenetic profile , Weight matrix & Motif alignment |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| gltA | glutamate synthase operon | ND | Positive | 2013955..2013969 | -71:-57 | ATCTCATTTTGAGAT |
DB DP SDM | Belitsky BR, et al. | 1997 |
| gltA | glutamate synthase operon | ND | Positive | 2013933..2013947 | -49:-35 | ATCTAAATTATATAT |
DB DP SDM | Belitsky BR, et al. | 1997 |
| gltR | ND | ND | Negative | 2725007..2725021 | -10:+5 | ATTCAAAATTAAGAT |
DB DP SDM | Belitsky BR, et al. | 1997 |
| gltR | ND | ND | Negative | 2725019..2725043 | +3:+37 | GATGGAAGACATCTCAAAATCAGATATCAACTATG |
DB DP SDM | Belitsky BR, et al. | 1997 |