| Factor type | GntR |
|---|---|
| SWISS-PROT | P10585 |
| SubtiList | BG10648 |
| Consensus seq. | ATACTTGTATACAAGTAT |
| Comment | negatively autoregulates the expression of the gntRKPZ operon becomes inactivated by gluconate suggested consensus of the gntR family is ACNNNTATANANNTAT |
| Link to | Phylogenetic profile |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| gntR | gntRKPZ | ND | Negative | 4112397..4112418 | -10:+12 | ATACTTGTATACAAGTATACTC |
SDM GS FT | Yoshida K, et al. | 1995 |